| Principal Investigator : Sher Ali
Project Associates
/ Assistants Ph D Students Collaborators In
humans, a gene AZF on the Yq11 region is reported to be necessary for
regulation of spermatogenic process suggesting a critical role of the Y-
chromosome. However, Y chromosome alone is insufficient for the control and
regulation of spermatogenesis since several genes and paracrine control
systems are known to regulate this phenomenon. Protooncogene c-kit receptor is
one such gene with pleiotropic attributes, implicated in controlling
spermatogenesis, hematopoiesis, and melanogenesis. A high level of
organizational similarities in the localization and expression of c-kit
receptor protein in human and rodent systems suggest that the gene undergoes
similar if not identical molecular events in these species. Thus, experimental
data obtained from rodents may allow direct comparisons of c-kit role(s) in
the human system. With this background, we undertook characterization of mRNA
transcripts of protooncogene c-kit receptor in somatic tissues and germline
using brown Norway fertile and infertile rats as model systems. The objectives
of the project are (i) expression of c-kit mRNA transcripts from different
somatic and germline tissues employing Northern blot and RT-PCR approaches,
(ii) cloning and characterization of RT-PCR generated c-kit mRNA transcripts
from testis representing different stages of postnatal development, (iii)
characterization of the c-kit receptor mRNA transcripts in infertile male rats
including histological assessment of the testis from these animals and (iv)
database search for comparative analysis of cDNA and protein sequences of
protooncogene c-kit receptor from different species. Characterization
of c-kit receptor mRNA transcripts in fertile and infertile rats In
the context of comparative genomics, we characterized pleiotropic
protooncogene c-kit receptor mRNA transcripts in germline and somatic tissues
using brown Norway fertile and infertile rats as model systems.
Fertility/infertility status of the animals was assessed by testicular
histology. Brown
Norway infertile (BNIF) rats showed abnormal testicular histology Testes
sections of the fertile animals showed normal morphology with folded and
convoluted seminiferous tubules. However, all the five infertile rats showed
varying degrees of abnormalities in testicular morphology from low count (oligospermia)
to complete absence (azoospermia) of the sperms. BNIF-i showed loose
arrangement of the pachytene spermatocytes and other cell types suggesting
lack of interaction among the cells required for normal testicular
development. BNIF-ii and iii showed regressed tubules, virtually devoid of
germ cells with large intercellular spaces. The cellular integrity was
completely lost since no individual cell-type could be identified in these
animals. The BNIF-iv rat was found to be devoid of spermatozoa and showed
botchy arrangement of the cells. Similarly, BNIF-v showed degenerated tubules
and sloughing off of the cells into the lumen. Thus, the testes of all the
infertile rats were found to be grossly abnormal. Subsequent studies showed
mutant mRNA transcripts in these infertile animals. Brown
Norway infertile (BNIF) rats showed mutational hotspot(s) in the c-kit mRNA
transcripts Having
shown gross anatomical abnormality in the testis of brown Norway infertile (BNIF)
rats, we analysed a correlation between infertility and c-kit gene expression
and mutation. In order to analyze mRNA sequences within the Ig 1 domain of the
c-kit receptor (Fig. 1) and the spliced variants (if any) in the BNF and BNIF
rats, primers specific to this domain spanning exons 1 and 2 were used (Table
1a) and corresponding amplicons are given in the Table 1b. The amplicon
generated by primer set 2 and 4 was characterized in details.
Expression
of the c-kit gene from different tissues of normal (fertile male) rats by
RT-PCR with the above mentioned primer set (2 and 4) showed the presence of an
expected 352 bp band. In addition, a 276 bp transcript with similar signal
intensity was detected in all the tissues barring heart that showed reduced
signal. To confirm that the 276 bp was not a spurious amplicon, the RT-PCR
blot was hybridized with random labeled c-kit cDNA probe under stringent
conditions. The BNIF rats, however, showed different results compared to those
from the control animals. BNIF-i showed a 352 bp band in all the tissues, but
the novel 276 bp transcript was observed only in the brain. BNIF-ii clearly
showed only the 352 bp but not the 276 bp transcript while BNIF-iii, iv and v
showed both 352 and 276 bp transcripts with varying signal intensities. The
differential expression of these mRNA transcripts in BNIF rats corresponds to
varying levels of histological aberrations in the testis. Table-1a:
Details of the oligo primers used for RT-PCR amplification
encompassing different domains of protooncogene c-kit receptor *Primer
Length
Nucleotide positions
Sequences of the primers No.
5'®3' 1
20
17-36
GAGCTCAGAGTCTAGCGCAT 2
19
24-42
GAGTCTAGCGCAGCCACCG 3
19
147-165
TCTCCACCATCCATCCAGC 4
21
355-375
CGAACACGTAAATAGAGCTCC 5
21
466-486
CACAGGTGTCCAATTACTCCC 6
20
625-644
GAATTTGTCAGACCGCATCC 7
20
692-711
GGAGATGACTTGTTTCGGGC 8
21
714-734
AAGGAAGGGGACACATTTACG 9
19
854-872
TTACGAACGCCAGGAGACG 10
22
846-867
CCTGGCGTTCGTAATTGAAGTC 11
21
898-918
ACATGAACACTCCGGAATCGT 12
21
1049-1069
TAGGCCTCGAACTCAACAACC 13
25
1732-1756
AGGAGATAAATGGGAACAATTATGT 14
20
1758-1777
AGCTGCGTTGGGTCTATGTA 15
22
2485-2506
TAGCCAGAGACATCAGGAATGA 16
25
2545-2569
CTTCCTTGATCATCATGTAAAACTT 17
20
3714-3733
GTATGAACGCATACAACGTA 18
20
b-actin, forward
GTGGGCCGCTCTAGACACCA 19
25
b-actin, reverse
CGGTTGGCCTTAGGGTTCAGGGGGG *These primers were deduced from the c-kit cDNA of the rat Rattus norvegicus brain. Table-1b: Details
of the RT-PCR generated amplicons with different sets of primers Primer
pairs
Tm (0C)
Amplicon size (bp) *#a
1-10
57
850 *#a
1-14
56
1760 *#ab1-17
54
3716 *2-4
62
352 *3-6
64
498 *5-7
63
246 *8-11
65
205 #13-16
55
971 *9-12
65
216 #b15-17
54
1248 b-actin,
18/19
60
245 Primers derived from, *extracellular
domain; To
assess the biological significance of the 352 bp and 276 bp transcripts in BNF
and BNIF rats, the amplified cDNA were cloned and sequences analysed. The 276
bp transcript in BNF and in BNIF rats showed identical sequences (Accession
number: AF 296692). A Blast search revealed a signature sequence for the mouse
testis specific protein, Tpx-1, within the 276 bp transcript. This mouse
protein is known to have a human homologue, TPX-1, as well. Putative ORF
analysis and motif search revealed the presence of a full-length peptide with
a high coding potential. The 276 bp transcript was detected in all the tissues
of BN fertile rats as well as normal Wistar rats, used subsequently to
ascertain the sequences of this transcript. Sequence
analysis of the 352 bp mRNA transcripts from each of the infertile rats
clearly showed that out of five, three carried mutations within the same locus
resulting in a defective receptor. BNF rats showed intact 352 bp mRNA
transcripts in the brain and testis. Among the infertile ones, BNIF-i showed a
3 bp deletion replacing leucine and threonine with an arginine residue at
amino acid positions 56 and 57 respectively. BNIF-ii showed multiple mutations
including a transversion of T’!A resulting in replacement of a cysteine58 by
serine. In addition, a critical tryptophan residue was changed to arginine82.
Of all the transcripts sequenced, almost 50% showed mutation suggesting a
heterozygous state of the c-kit gene. The BNIF-iii rat showed a deletion of
nucleotide ‘T’ resulting in the truncation of the c-kit receptor peptide.
The BNIF-iv and v rats did not show any mutation in the 352 bp transcripts.
Similarly, the brain transcripts from each of these infertile animals,
sequenced independently were also found to be devoid of the mutations observed
in the testicular transcripts. Alignment
of the sequences from the mutated transcripts of BNIF-i and ii, at both cDNA
and protein levels showed the presence of mutational hotspots within the
nucleotides 209-217. A comparison of BNF and BNIF rat brain c-kit amino acid
residues L, T and C at position 56, 57 and 58, respectively showed that in
BNIF-i rat, ‘L’ and ‘T’ residues were affected whereas in BNIF-ii the
‘C’ was affected. Further, the tryptophan (W) residue in normal c-kit is
replaced by arginine (R) in the BNIF-ii rat. In order to rule out any
artifact, each mRNA transcript was sequenced independently at least three
times. The sequences of all the five 352 bp transcripts from BNIFi-v rats were
deposited in the GenBank (Accession numbers- AF 228307 to AF 228311). Gross
deletion of the c-kit cytoplasmic domain RT-PCR
generated transcripts from the Ig 1 domain crucial for ligand binding showed
mutations in three (BNIFi-iii) infertile rats whereas, BNIF-iv and v rats had
the wild type sequence. However, abnormalities in the testicular morphology
with depleted stem cells were seen in all the five animals. Since an intricate
balance between c-kit and SCF is required for stem cell proliferation,
differentiation and survival, this suggested that the c-kit gene had lost its
function in BNIF-iv and v rats as well. To assess the status of the
full-length c-kit transcripts, primers (1 and 17) spanning all the domains
were used independently for studying their expression in each of the infertile
rats. Except for BNIF-iv, all the other infertile rats showed normal
expression with primers derived from ECD, cytoplasmic domain, 3’ UTR and
5’ UTRs. The absence of transcript in BNIF-iv was confirmed by Southern blot
hybridization of the RT-PCR products with a labeled c-kit cDNA probe. b-actin
amplification used as control showed uniform signals in all the samples
indicating almost equal quantity of cDNA template in the reaction. We infer
that the absence of full-length c-kit transcript in BNIF-iv rat was due to the
deletion of sequences from the transmembrane and the cytoplasmic domains. Immunodetection
of the c-kit protein, level makes a difference Total
proteins from BNF and BNIF rat testes resolved on a reducing 12% SDS-PAGE and
blotted with a c-kit monoclonal antibody showed the presence of two proteins
of ~ 150 kDa and 48 kDa with varying signal intensities. The b-actin signal
was used to normalize the c-kit signal. The protein levels in the two
infertile rats BNIF-ii and iii were not dramatically different as compared to
that observed in the normal fertile ones. In the control experiment, normal
rat IgG was used that did not show cross-reaction with c-kit monoclonal
antibody. BNIF-i with a 3 bp deletion in the mRNA transcript showed abundance
of 150 kDa protein. BNIF-ii and iii showed reduced level of full-length
protein but higher level of 48 kDa protein. However, the ratios of 48:150 kDa
proteins in both the animals were similar. In BNIF-iv, 150 kDa full-length
peptide was absent due to deletion of cytoplasmic domain as mentioned earlier,
although 48 kDa protein representing the soluble c-kit receptor from ECD was
present. In BNIF-v, no mutation was detectable at the cDNA level. This may be
due to the absence of splicing junction or splice factors at GNNK position in
the juxtamembrane region resulting in the presence of a single 150 kDa c-kit
protein and complete absence of the 48 kDa one. Aberrant
c-kit mRNA transcripts, implications in infertility In
the present study, severity of abnormal testicular morphology was directly
correlated with mutations in the c-kit gene. The transformation of
spermatogonial stem cells into differentiated haploid spermatozoa is a complex
process dependent upon Sertoli cells. As mentioned earlier, the SCF/c-kit
system facilitates the Sertoli cell-germ cell interaction since SCF is
expressed specifically in the Sertoli cells while its receptor is on stem germ
cells. Mutation in any of these genes is envisaged to impede the process of
spermatogenesis. Our expression study on c-kit showing mutant mRNA transcripts
in the testes and not in any of the somatic tissues support this view and is
in accordance with the abnormal testicular histology observed in the infertile
animals. Based on these results, it is tempting to suggest that spermatogenic incompetence in the brown Norway rats leading to infertility is directly or indirectly caused due to aberrant c-kit receptor proteins by altered signaling and its downstream effects. Publications Original
peer-reviewed articles 1.
Kapur V, Prasanth SG, O’Ryan C, Azfer MA and Ali S (2003) Development
of a DNA marker by minisatellite associated sequence amplification (MASA) from
the endangered Indian rhino (Rhinoceros unicornis). Mol Cell Probes 17:1-4. 2.
Bashamboo A, Bhatnagar S, Kaur A, Sarhadi VK, Singh JR and Ali S (2003)
Molecular characterization of a Y- derived marker chromosome and
identification of indels in the DYS1 region in a patient with stigmata of
Turner syndrome. Curr Sci 84:219-224. 3.
Kumar A, Arora V, Bashamboo A and Ali S (2002) Detection of Salmonella typhi
by polymerase chain reaction: Implications in diagnosis of typhoid fever. Infection,
Genetics and Evolution 2:107-110. |
