Molecular analyses of human and animal genome(s)

 
Principal Investigator :  Sher Ali

Project Associates/Assistants
Nicky Xavier
PC Sebastian
Md Mahidur Rahman
Deepali Pathak
Aparna Prasad
Jyoti Srivastava
A Kalpana

Ph D Students
Sanjay Premi

Colloborators
Lalit C Garg

The Protooncogene c-kit receptor having pleiotropic attributes is involved in control of spermatogenesis, hematopoiesis, and melanogenesis. Pattern of c-kit receptor protein expression in human and rodents show high level of similarities suggesting that this gene operates under similar, if not identical, conditions. Thus, study on c-kit receptor is envisaged to enhance our understanding on its role in control and regulation of fertility in the human system. The objectives of the project are (i) expression of c-kit receptor in Brown Norway rat R.norvegicus testis during different stages of postnatal development, analyzing each of the domains independently, (ii) comparative analyses of rat c-kit cDNA sequences in related genomes using sequences from the GenBank and (iii) assessing phylogenetic potential of the organizational uniqueness of the sequences within the extracellular domain of c-kit gene.

Expression of protooncogene c-kit receptor in rat testis and uniqueness of extracellular domain across the species with potential in molecular phylogeny

We studied expression of protooncogene c-kit receptor in Brown Norway rat R.norvegicus testis during different stages of postnatal development. Several regions from within the c-kit gene encompassing different domains were amplified employing reverse transcriptase polymerase chain reaction (Table-1) and the resultant amplicons were cloned and characterized. Maximum expression of c-kit was observed in the testis during the days 10 to 30 suggesting its involvement in transition of primary spermatocytes towards formation of mature spermatozoa. Multiple novel transcripts originating from the extracellular domain were also identified, though their functions remained unknown. The evolutionary divergence of c-kit cDNA of 11 other vertebrates was studied downloading their sequences from the GenBank. Analyses of c-kit cDNA and its protein sequences in rat and related genomes showed organizational uniqueness across the species. Construction of phylogenetic tree, based on c-kit cDNA and protein sequences delineated all the species successfully and was found to be in accordance with the established positioning of these animals. This may be exploited as a tool in delineating phylogenetic relationship of different species.

Extracellular domain of c-kit in R.norvegicus reveals variant mRNA transcripts

The c-kit mRNA transcripts in testis from different stages of postnatal development identified by RT-PCR were found to show size variation in the ECD. Primers derived from the extracellular domain (nucleotides 17-867) including 5’UTR showed several still uncharacterized transcripts of about 700, 600 and 550 bps in addition to the major expected one of 850 bp. These transcripts were relatively more prominent in the testis samples obtained during days 10-30. Assessment of amplicons generated with primers specific to 3' untranslated region revealed an alternate 3' UTR transcript of 600 bp in addition to the 1.25 kb expected one. Transcriptional analysis from the cytoplasmic domain and the entire c-kit cDNA showed a single amplicon each of the expected size of 971 bp and 3.7 kb, respectively. Differential expression of c-kit during different stages of postnatal development was seen despite similar quantities of template DNA used for reaction. This was evident from the b-actin RT-PCR amplification used as control for quantification of cDNA showing similar signal intensity.

Table-1: Oligo primers encompassing all the domains of c-kit cDNA of rat Rattus norvegicus used for RT-PCR amplification

Set of primers
 
Nt position

Sequences of primers
5'-3'

Amplicon
length (bp) 
Accession
number
*#a17-867  GAGCTCAGAGTCTAGCGCAT
CCTGGCGTTCGTAATTGAAGTC
(20) 
(22)
850 AF296694
#1732-2569 AGGAGATAAATGGGAACAATTATGT
CTTCCTTGATCATCATGTAAAACTT 
(25)
(25)
971 AF296693
#b2485-3733 TAGCCAGAGACATCAGGAATGA  
GTATGAACGCATACAACGTA 
(22)
(20)
1248 ND
17-3733 GAGCTCAGAGTCTAGCGCAT
GTATGAACGCATACAACGTA 
(20) 
(20) 
3716 ND

*   Primers derived from extracellular domain; # cytoplasmic domain; #a includes 5’UTR;
#b 
includes 3' UTR, nt denotes nucleotide positions; ND-not done.
(See also Prasanth and Ali, 2003)

Evolutionary divergence of c-kit cDNA in two species of rats, R.rattus and R.norvegicus

As mentioned earlier, c-kit receptor gene is highly conserved with an equally conserved biological function. However, in the present study, tissue-specific organizational variation of the sequences within and between the two species of rats (R.norvegicus and R.rattus) was observed without an alteration in the overall charge of the protein. The nucleotide changes within the ECD of the c-kit suggest that evolutionarily, these are not unfavored and perhaps reflect fixation of allele.

Sequences from the RT-PCR generated amplicons of testis representing all the domains of the c-kit receptor from R.norvegicus were compared to the known c-kit cDNA of the R.rattus brain by blast similarity search using NCBI default server (http://www.ncbi.nlm.nih.gov/blast). The result showed 80-90% homology at the cDNA level and 92-96% at the amino acid sequence level involving alteration of the “aa” I®F and L®F (non-polar), DÛE (acidic) and N®S (polar uncharged) residues. Functionally, the 4-8% variation at “aa” level was insignificant because it did not alter the overall charge of the protein. However, this work led to an important observation that organizational uniqueness of c-kit cDNA maintained across the species was reflected even between the two closely related species of rats. The variations observed at the nucleotide sequence level are greater than that at amino acids level clearly distinguishing the two species of rats.

Homology of c-kit cDNA and protein sequences amongst different species

Clustal W based multiple alignment of c-kit cDNA from eleven different species (Table-2) revealed primary structure of c-kit to be highly conserved, although no consensus sequence could be deduced at the 5' and 3' UTRs. Protein sequence alignment showed maximum variation within the extracellular domain amongst different species indicating 36.2% completely conserved, 36% highly conserved and 10.7% fairly conserved residues, amounting to a total of 82.9% homology. In contrast, rest of the c-kit receptor showed 78.6% completely conserved, 11.9% highly conserved and 4.8% fairly conserved sequences giving rise to a total of 95.3% homology. The Cysteines (C) and Tryptophans (W) in the extracellular domain were completely conserved. The GNN/SK motif, a known splice site in the juxtamembrane domain was absent in mouse, horse and chick. Multiple alignment of amino acid sequences showed high level of conservation in closely related species such as cattle and goat, and rat and mouse (data not shown), where L® V; V®G; F® L; E®T changes occurred only in mouse and rat. Similar changes (e.g. C®F) were observed in the cattle and goat. Non-conserved changes in the amino acids were observed at the same position in all the species conferring organizational uniqueness of c-kit gene in these animals.

Table-2:  Sequences of c-kit cDNA of eleven different speicies with their Gene Bank accession numbers
  (http://www.ncbi.nlm.nih.gov/entrez)

  Species Accession No.
Cattle  Bos primigenius  D16680
Goat  Capra hircus   D45168
Cat  Felis catus  S76596
Horse   Equus caballus AF055037
Human Homo sapiens  XO6182
Mouse   Mus musculus   Y00864
Rat  Rattus rattus    D12524
Chick   Gallus gallus     D13225
Xenopus  Xenopus laevis    Z48770
Zebrafish Danio rerio  AF153446
Dog Canis familiaris AF099030

Upregulation of c-kit expression in rat R.norvegicus testis

The requirement of c-kit for the migration of gonocytes to produce type A spermatogonia has been well established. In the present study, maximum signal in testes during the days 10 to 30 and detection of transcripts in addition to the expected ones suggested up-regulation of the c-kit gene and its alternative splicing. Thus, up-regulation of c-kit expression substantiates its role in meiosis and spermiogenesis.

Evolutionary conservation of c-kit protein

The c-kit receptor comprises 5 Ig-like domains in the extracellular domain besides multiple intermolecular disulfide bonds. The conservation of disulfide bonds guarantees that the overall topology and tertiary structure of the c-kit receptor remains the same in all the species. This is corroborated by the fact that interspecies chimeras of the c-kit molecule can be created without significant loss of functional activity. In the present study, tryptophan residue crucial for biological activity of the receptor was found to be conserved. This is in accordance with the earlier observation where mutations involving tryptophan residues in the extracellular domain of c-kit in humans were found to downregulate receptor function.

Phylogenetic potentials of c-kit receptor

Phylogenetic trees based on c-kit cDNA alignment from different species showed a close relationship between rat and mouse, goat and cattle and dog and cat. On the other hand, Xenopus, chick and zebrafish were found to be the most distant species. The bootstrap values of most of the nodes were greater than 90% in the neighbour joining trees. However, in the maximum parsimony tree, the branches comprising human and horse were not supported by high bootstrap value as it was only ~59%. Nonetheless, the overall positioning of the species was found to be in accordance with the established phylogenetic trees based on paleontological records.

The c-kit gene exemplifies evolution of ECD in a species-specific manner while retaining its biological functions across the species. Thus, sequences from the ECD may be exploited for the phylogenetic analysis of the species.

Publications

Original peer-reviewed articles

1.     Prasanth SG, Chattopadhyay M, Bhat KV and Ali S (2004) Expression of protooncogene c-kit receptor in rat testis and uniqueness of extracellular domain across the species with potential in molecular phylogeny. DNA Cell Biol 23:35-43.

2.     Prasanth SG and Ali S (2003) Expression of protooncogene c-kit receptor in rats Rattus norvegicus and identification of a mutant mRNA transcript implicated in spermatogenic failure. DNA Cell Biol 22:447-456

Reviews/Proceedings

1.     Prasanth SG, Giran HM and Ali S (2004) Biology of protooncogene c-kit receptor and spermatogenesis. Curr Pharmacogenomics 2:1-14.

2.     Ali S and Hasnain SE (2003) Genomics of the human Y -chromosome: 1- association with male infertility. Gene 321:25-37.

3.     Bashamboo A, Giran HM, Azfer MA and Ali S (2003) Genomics of the human Y chromosome and molecular diagnosis. Proc Ind Nat Sci Acad B69:525-528.