|
Functional
comparison of Sertoli cells isolated from spermatogenetically active and
inactive testis to elucidate role of Sertoli cells in spermatogenesis and
infertility |
Principal Investigator : Subeer S Majumdar Project Associates/Assistants
Ph
D students
Collaborators This
project has been undertaken to understand the mechanism of Sertoli cell (Sc)
regulation of spermatogenesis in primates and rodents and paracrine
interaction within the testis. This information would lead to proper
evaluation and management of human infertility caused due to seminiferous
tubular dysgenesis, which is untreatable at present. Additionally, several
unknown factors of seminiferous tubular origin important for the occurrence of
spermatogenesis in mature testis may be identified by this study and used as a
tool for achieving non-hormonal contraception in the males. The
objectives of the project are to (i) evaluate functions of Sc from
spermatogenetically inactive (infant) and active (pseudoadult) monkey testis,
(ii) compare Sc functions from these two developmental stages for identifying
processes and factors important for spermatogenesis, (iii) study testicular
cell-cell interaction in vitro.and (iv) undertake similar studies using
10 and 40/60 days old rats. Hormonal
regulation FSH In
the past, we have shown that rmFSH failed to augment Sc lactate and inhibin
production. However, a major concern remained about the bioactivity of such
recombinant preparation. To resolve this issue, rat Sc were treated with rmFSH
and it was found that lactate production by rat Sc increased significantly due
to this treatment. Additionally, cAMP radio-immunoassay was standardized and
we found that cAMP production increased in response to addition of rmFSH to
the pseudoadult monkey Sc. These results validated our earlier studies using
rmFSH. Most interestingly, we found by quantitative RT PCR (QRTPCR) using
primers and probes for human FSHR [forward
primer:5„-ATGCAGCTGGACTGCAAGG-3„; reverse primer:
5„-GCAAAAATCCAGCCCATCAC-3„; probe:5„-/56-FAM/TCCGCCATGCTGCCAGTGTCA
T/36-TAMTph/-3„] and b-glucouronidase
as the housekeeping gene that infant monkeys have 20 or more fold lesser FSHR
than that found in pseudoadult Sc (n=3 monkeys in each group). Cyclic AMP data
further corroborated these findings. Androgen Quantitative
RT PCR studies of monkey (n=3) Sc RNA using primers and probes for human AR
gene showed a significantly lesser expression of AR mRNA in infant monkeys as
compared to the pseudoadults. Our observation of diminished AR expression in
the infant Sc lent an authentic explanation to the previously observed low AR
binding activity in this age group. Reduced
FSH and androgen receptor activity in infants seems to be primarily
responsible for the lack of spermatogenesis in the phase of adequate hormones
in infant primates. Protein
analysis Metabolic
labeling of monkey Sc secreted proteins with 35S
methionine and analysis of these proteins using 2D-PAGE followed by
fluorography revealed differential pattern of protein secretion by infant and
pseudoadult monkey Sc. Thirteen protein spots were found to be unique
to infant Sc, while five protein spots were unique to pseudoadults. Although
radioactive protein spots were visible in the fluorograms, the protein content
of each spot was not in the range required for carrying out confirmatory
analysis by determining their amino acid sequence. Further characterization of
proteins unique to infant or pseudoadult monkey Sc was carried out using
proteins free from radioisotope. The proteins were resolved by 2D-PAGE and
detected by silver staining (Figure-1). The protein spots unique to either
infant or psuodoadult Sc were identified in the silver stained gels and
characterized using MALDI-TOF-MS and MALDI-TOF-MS/MS. MI-1, a protein spot
specific to infant monkey Sc was identified as apolipoprotein A-I (apo A-I).
As a major protein component of
high density lipoproteins (HDLs), apo
A-I has been postulated to participate in a reverse cholesterol transport
pathway in extrahepatic cells and accumulation of cholesteryl esters in the
steroidogenic cells.
Figure-1:
Comparison of silver stained
protein spots in the 2D-PAGE of secreted proteins from infant and pseudoadult
monkey Sertoli cells Another
interesting finding in the protein identification study was that three spots
(MI-2, MI-3, MI-4, all specific in infants) with different molecular weights
and pIs were identified as Mullerian inhibiting substance (MIS). In
addition to its principle role in regression of Müllerian ducts in the
differentiating testis, the post-natal continuation of MIS expression supports
the hypothesis that MIS may have other roles such as regulation of gonadal
function, testicular descent, lung development, and regulation of Gc
development. Validation of the hypothesis that MIS has a role in the
regulation of Gc development may have great relevance in the diagnosis and
treatment of certain cases of male infertility. Another
low molecular weight protein (MI-5a, also specific to infants) was identified
as pigment epithelium-derived factor. This protein has been shown to inhibit
vascular endothelial growth factor, which is a potent mitogen. Its presence in
infant testis may be responsible to limit the growth of testicular cells at
this age. While a protein from pseudoadult monkey Sc (MA-11) was identified as
an un-named protein, which was recently submitted in the database by other
investigators. Its function is not yet defined. Cell-cell
interaction in the testis These
studies are being carried out in rats. Peritubular cell (PTc) culture (>70%
pure) has been standardized and it was found (in 2 sets of studies) that media
from PTc cultures suppress Lc testosterone production, in vitro.
Studies of effects of Sc on Lc and vice versa are also being carried
out.
Publications Original peer-reviewed articles 1.
Nagarajan P, Venkatesan R, Mahesh Kumar MJ and Majumdar SS (2004) Supression
of lactation in post weaning Macaca radiata females by bromocriptine
under laboratory conditions. Laboratory Primates LPN43:12-13. 2.
Mahesh Kumar MJ, Nagarajan P, Venkatesan R, Sakthivelan SM and Majumdar SS
(2004) Sebaceous gland adenoma in a rhesus monkey. J Med Primatol (in
press). |
