pubim1

Comparative genomics facilitates the understanding of organization, evolution and expression of genes in diverse genomes. In this context, we studied satellite tagged transcribing sequences in bubaline (Bubalus bubalis) genome as model system. Involvement of satellite sequences in conferring modulation in the germ line as a possible mechanism of gene inactivation was addressed. This approach is promising towards resolving the molecular nature of the sequences tagged with some still uncharacterized satellite fraction(s). The objectives are to identify satellite fraction(s) employing restriction survey on the genomic DNA, clone and characterize satellite fraction for its genomic organization and evolutionary conservation, study expression of these sequences in different tissues and ascertain possible sequence modulation, if any, in the germline samples.

Satellite tagged transcribing sequences in the bubaline Bubalus bubalis genome undergo programmed modulation in the meiocytes

The present study was undertaken in the context of comparative genomics. We cloned and sequenced a 1378 bp BamHI satellite DNA fraction from the bubaline Bubalus bubalis genome and studied its expression in different somatic tissues and germline. The GC rich sequences of the resultant clone pDS5 (accession # Y-07658) cross-hybridize only with bovids DNA and not conserved evolutionarily. AluI typing of DNA from bubaline semen samples showed consistent loss of two bands. Presence of corresponding bands in somatic tissues suggests a possible sequence modulation within the pDS5 array in meiocytes during spermatogenesis, which is restored back in the somatic cells after fertilization. Modulation of satellite tagged transcribing sequence in the meiocytes may be a possible mechanism of its inactivation.

Clone pDS5 does not uncover restriction fragment length polymorphism in the bubaline tissue

Detailed DNA typing of somatic tissues (blood, lung, liver, kidney, heart and spleen), testis and ovary with a number of enzymes showed multilocus monomorphic profile. Typing with BamHI enzyme using DNA from blood samples of different breeds and a non-descript one, revealed a total of 18 monomorphic bands of varying signal intensities and an expected 1.378 kb prominent band. Similarly, EcoRI digested DNA samples showed about 17 discernible monomorphic bands in the range of 27 kb to 800 bp whereas RsaI enzyme uncovered a total of 29 monomorphic bands of varying signal intensity. Such monomorphic band profile indicates that these sequences are free from molecular events leading to polymorphism and most probably are transcribed. In subsequent expression study, the pDS5 sequences were found to be transcribing.

RNA slot blot hybridization with pDS5 and its five-subset sequences revealed varying levels of signals in different somatic tissues and germline. Strongest signal was detected in spleen and testis followed by kidney. However, no signal was seen in heart, liver and ovary by slot blot analysis. Hybridization of the same blot with b-actin showed comparable signals in all the samples indicating presence of mRNA in these samples. Northern blot analysis showed varying signal intensities in spleen and testes of which a band of about ~9 kb was prominent in spleen whereas the remaining somatic tissues such as heart, kidney, lung, liver and ovary showed no signal. In order to confirm pDS5 expression in different tissues, RT-PCR amplification was conducted with three sets of internal primers derived from pDS5 (Table-1) followed by its hybridization with the same. Amplification with primer set 3 uncovered signals of varying strength in all the somatic tissues and germline detecting faint one in liver and lung but no signal in heart. The RT-PCR blot hybridized with pDS5 revealed a single band of varying signal intensity being most prominent in spleen and testis, least in lung and liver but absent in the heart. The RT-PCR amplification was conducted thrice independently with cDNA from different tissues including heart using all the three sets of primers but the results of the hybridization pattern remained unchanged. However, used as control for RT-PCR amplification, b-actin primer showed signal in heart.

Table-1: Details of pDS5 derived oligo primers used for RT-PCR amplification

Serial number	Primer sets and nt positiona	Primer sequences 5'--------3'	Annealing temperature (°C)
1	F (1-22) R (351-372)	GATCCTGTGGAGGTGGCGGGGC GCTCTTGAGAAGGACCCGAGGC	70
2	F (285-306) R (653-675)	GTGTTGTGCCTTCACCCACAGG CCCACCACTTGGCAAGATGAGGC	70
3	F (146-163) R (934-950)	GAGTCAGGCCTCGTCTTG GTCCTTGGCTTCCCTCG	58

Thus, varying level of transcription of pDS5 and its subset sequences in most of the somatic tissues (except heart) and germline was detected. Absence of signals in slot blot and northern blot with mRNA from kidney, liver, lung and ovary, even after longer exposure (up to 14-15 days), may either be due to its very low levels or due to possible degradation of the same. These tissues were found to be transcriptionally active as revealed by RT-PCR analysis. The control b-actin signal detected in heart suggests presence of mRNA. Thus, the results obtained by slot and northern blot analyses with respect to heart was found to be in accordance with RT-PCR data confirming that pDS5 is not transcribed in this tissue.

High level of pDS5 homology with a-collagen VII gene encompassing exons 41 to 65 (BLASTX search result) is one of the most significant observation of this study. As mentioned above, a 9 kb transcript was detected in the present study. Transcript of similar size for collagen gene has been reported in the literature. Further, pDS5 translation into protein from nt 1-1261 bp followed by its database search showed high level of amino acids sequence homology with human collagen VII gene. The BLAST search suggests that pDS5 sequences from nt 1-1261 bp represent collagen gene whereas nt 1262-1378 bp in the 3' region represent satellite fraction (http://www.ncbi.nlm.nih.gov/blast/Blast.cgi).

Yet another important observation of this study was that of the several enzymes used for DNA typing of buffalo blood and semen samples of the same males with pDS5, AluI was found to be most informative and detected several bands with varying signal intensity. Of these, four bands of about 860, 680, 420 and 340 bp were common to both semen and blood samples and three (680, 420 and 340 bp) showed conspicuous copy number variation. Interestingly, two bands of about 630 and 370 bp seen in the blood samples of all the males were conspicuously absent in the semen samples. However, other enzymes used for typing showed identical band pattern in both semen and blood DNA samples.

Absence of two, 630 and 370 bp, bands in buffalo semen samples detected by AluI typing suggests modulation of the subset sequences of pDS5 array, leading to a programmed molecular transaction from somatic cells to germline and vice-versa. This may be caused due to alteration of restriction recognition sites within the pDS5 contig. Consistent presence of these bands in the blood samples suggests that restriction sites are faithfully restored after fertilization. Alu repeat has been implicated with allele length variation, haplotype diversity, mutations and frequent gain or loss of the repeat unit(s) and a high level of polymorphism in pigs and human genomes. With pDS5, no Alu repeat sequence homology was found.

However, three AluI sites at nucleotide positions 226, 791 and 1115 were found to be present. It is inferred that AluI sequences in pDS5 act as recombinational hot spots leading to alteration of restriction sites in the meiocytes and this may be a control mechanism of collagen gene inactivation during spermatogenesis. Despite its homology with human collagen gene, pDS5 does not show cross-hybridization with total human genomic DNA. This is construed to be due to the large size of variable intronic sequences that seem to separate the exons wide apart impeding its hybridization. Sequence modulation in the present study is analogous to antibody genes known to rearrange from original ‘germline configuration’ to ‘somatic configuration’. Similar sequence modulation has also been observed in the bubaline semen DNA samples using another satellite derived primer employing the minisatellite associated sequence amplification. Thus, in addition to pDS5, this phenomenon seems to be operative with respect to other satellite tagged sequences as well. Programmed modulation of pDS5 in the bubaline meiocytes, its shrinkage (low copy number) in the related bovids (our earlier work) and apparent absence of the same in non-bovids (present study) suggest its independent evolution in bovids. From the data, it is tempting to speculate the involvement of pDS5 satellite in tandem multiplication of collagen gene, giving rise to about 2000 copies in the bubaline genome.

1. Chattopadhyay M, Gangadharan G, Kapur V, Azfer MA, Prakash B and Ali S (2001) Satellite tagged transcribing sequences in the bubaline Bubalus bubalis genome undergo programmed modulation in the meiocytes: Possible implication in transcriptional inactivation. DNA Cell Biol 20:587-593.

2. Ali S and Hasnain SE (2002) Molecular dissection of the human Y chromosome. Gene 283:1-10.

3. *Bashamboo A and Ali S (2001) Minisatellite associated sequence amplification (MASA) of the hypervariable repeat marker 33.15 reveals a male specific band in humans. Mol Cell. Probes 15:89-92 (*in press last year, since published).

4. Mohmmed A, Sharma RS, Ali S and Babu CR (2001) Molecular diversity of the plasmid genotypes among Rhizobium gene pools of sesbanias from different habitats of a semi-arid region (Delhi). FEMS Microbiol Lett 205:171-178.

5. Gangadharan S, Kapur V and Ali S (2001) GATA/GACA repeat sequences are transcribed in the normal fertile rat Rattus norvegicus but not in the infertile ones. Curr Sci 81:1-5.

1. Ali S, Gangadharan S, Chattopadhyay M, Kaur S, Azfer MA and Mattapallil MJ (2001) Molecular mining of bubaline Bubalus bubalis genome through repetitive DNA. Proc Nat Acad Sci India 71(B):1-13.

2. Kapur V, Bashamboo A and Ali S (2002) Development of genetic markers specific for highly endangered species Rhinoceros unicornis: Strategies and implications in conservation. Ind J Biotech 1:96-100.